Found 3009 chains in Genus chains table. Displaying 1001 - 1050. Applied filters: Proteins

Search results query: Arc Repressor Mutant, subunit A

Total Genus Sequence Length pdb Title
129 368 3vytB Crystal structure of the hypc-hypd-hype complex (form i inward)
225 656 3w2wA Crystal structure of the cmr2dhd-cmr3 subcomplex bound to atp
167 633 3vslA Crystal structure of penicillin-binding protein 3 (pbp3) from methicilin-resistant staphylococcus aureus in the cefotaxime bound form.
26 82 3w6kB Crystal structure of dimer of scpb n-terminal domain complexed with scpa peptide
210 655 3w2vA Crystal structure of the cmr2dhd-cmr3 subcomplex bound to 3'-amp
42 168 3w6jB Crystal structure of scpab core complex
168 633 3vskA Crystal structure of penicillin-binding protein 3 (pbp3) from methicilin-resistant staphylococcus aureus in the apo form.
134 371 3vyrB Crystal structure of the hypc-hypd complex
118 367 3vyuB Crystal structure of the hypc-hypd-hype complex (form ii)
40 136 3vodA Crystal structure of mutant marr c80s from e.coli
51 151 3v4gA 1.60 angstrom resolution crystal structure of an arginine repressor from vibrio vulnificus cmcp6
42 136 3voeA Crystal structure of wild type marr (apo form) from e.coli
71 189 3vprA Crystal structure of a tetr family transcriptional regulator pfmr from thermus thermophilus hb8
100 322 3v8lA Crystal structure of staphylococcus aureus biotin protein ligase in complex with biotinyl-5'-amp
283 1066 3tw7A Structure of rhizobium etli pyruvate carboxylase t882a crystallized without acetyl coenzyme-a
93 322 3v8kA Crystal structure of staphylococcus aureus biotin protein ligase in complex with biotin
70 216 3v42A Crystal structure of renal tumor suppressor protein, folliculin
46 136 3vb2A Crystal structure of the reduced form of marr from e.coli
19 70 3vepA Crystal structure of sigd4 in complex with its negative regulator rsda
98 322 3v7rA Crystal structure of staphylococcus aureus biotin protein ligase in complex with inhibitor
135 438 3vdxA Structure of a 16 nm protein cage designed by fusing symmetric oligomeric domains
103 322 3v7cA Cystal structure of sabpl in complex with inhibitor
98 322 3v8jA Crystal structure of staphylococcus aureus biotin protein ligase
331 1071 3tw6A Structure of rhizobium etli pyruvate carboxylase t882a with the allosteric activator, acetyl coenzyme-a
21 62 3vfzA Crystal structure of -35 promoter binding domain of sigd of mycobacterium tuberculosis
98 322 3v7sA Crystal structure of staphylococcus aureus biotin protein ligase in complex with inhibitor 0364
188 657 3ungC Structure of the cmr2 subunit of the crispr rna silencing complex
185 656 3ur3C Structure of the cmr2 subunit of the crispr rna silencing complex
70 223 3u9gA Crystal structure of the zinc finger antiviral protein
23 58 3ulqB Crystal structure of the anti-activator rapf complexed with the response regulator coma dna binding domain
51 148 3u1dA The structure of a protein with a gntr superfamily winged-helix-turn-helix domain from halomicrobium mukohataei.
203 624 3u1kA Crystal structure of human pnpase
31 112 3u21A Crystal structure of a fragment of nuclear factor related to kappa-b-binding protein (residues 370-495) (nfrkb) from homo sapiens at 2.18 a resolution
49 138 3u2rA Crystal structure of marr transcription factor from planctomyces limnophilus
100 367 5froA Crystal structure of the prototype foamy virus (pfv) intasome in complex with magnesium and the insti xz446 (compound 4f)
151 444 4zdpA The crystal structure of y334c mutant of human sepsecs in complex with selenocysteine trna (trnasec)
79 276 3to7A Crystal structure of yeast esa1 hat domain bound to coenzyme a with active site lysine acetylated
25 91 5e3lA Crystal structure of fis bound to 27bp dna f1-8g (aaattggtttgaattttgagccaattt)
79 191 3tp0A Structural activation of the transcriptional repressor ethr from m. tuberculosis by single amino-acid change mimicking natural and synthetic ligands
80 276 3to6A Crystal structure of yeast esa1 hat domain complexed with h4k16coa bisubstrate inhibitor
222 666 4xbfA Structure of lsd1:corest in complex with ssrna
83 276 3to9A Crystal structure of yeast esa1 e338q hat domain bound to coenzyme a with active site lysine acetylated
110 352 3tkyA Monolignol o-methyltransferase (momt)
82 194 3tp3A Structure of hth-type transcriptional regulator ethr, g106w mutant
31 107 3tqnA Structure of the transcriptional regulator of the gntr family, from coxiella burnetii.
33 158 3tmoA The catalytic domain of human deubiquitinase duba
68 186 3tl4X Crystal structure of the trna binding domain of glutaminyl-trna synthetase from saccharomyces cerevisiae
26 91 5dtdA Crystal structure of fis bound to 27bp dna f1-8c (aaattcgtttgaattttgagcgaattt)
79 271 3tobA Human mof e350q crystal structure with active site lysine partially acetylated
73 271 3toaA Human mof crystal structure with active site lysine partially acetylated