Crystal structure of fis bound to 27 bp sequence dna f28 (aaatttgtttgagcgttgagcaaattt)
Total Genus 27
Loading diagram...

The genus trace: a function that shows values of genus (vertical axis) for subchains spanned between the first residue, and all other residues (shown on horizontal axis). The number of the latter residue and the genus of a given subchain are shown interactively.

Total Genus
sequence length
structure length
Chain Sequence
Loading diagram...

The genus matrix. At position (x,y) a genus value for a subchain spanned between x’th and y’th residue is shown. Values of the genus are represented by color, according to the scale given on the right.

Structure visualization

After clicking on a point (x,y) in the genus matrix above, a subchain from x to y is shown in color.

Chord Diagram
{{ tooltip.sname }} connected with {{ tooltip.tname }} : {{qFormat(tooltip.svalue) }}
molecule keywords DNA-binding protein fis
publication title Control of DNA minor groove width and Fis protein binding by the purine 2-amino group.
pubmed doi rcsb
source organism Escherichia coli
molecule tags Transcription/dna
total genus 27
structure length 91
sequence length 91
chains with identical sequence B
ec nomenclature
pdb deposition date 2012-12-19
Image from the rcsb pdb (www.rcsb.org)
cath code
ClassArchitectureTopologyHomologyDomain Mainly Alpha Orthogonal Bundle Arc Repressor Mutant, subunit A Homeodomain-like 4ihvA00
chains in the Genus database with same CATH superfamily
chains in the Genus database with same CATH topology
chains in the Genus database with same CATH homology

#chains in the Genus database with same CATH superfamily
 1LE8 A;  1IDZ A;  1X2M A;  5EEA A;  3A02 A;  2DMQ A;  3RQI A;  4C2M J;  4M3G A;  3BR1 A;  5J1R A;  1F36 A;  2LFB A;  2LLK A;  4IHX A;  4QSH A;  2OF7 A;  3FK6 A;  3G1M A;  1TC3 C;  3IV5 A;  3DEW A;  2GM4 A;  3H3V K;  5JLW A;  4W1U A;  3TED A;  4IEJ A;  3IH3 A;  4A3I J;  2HI3 A;  3BQY A;  5K7Z A;  3GTP J;  2E2J J;  4M3D A;  1IG7 A;  4BY7 J;  1WCM J;  3BR6 A;  1OJL A;  2NVY J;  1FIP A;  3GTK J;  2JJ7 A;  2K40 A;  1JKR C;  1GT0 C;  2Y9Y A;  4BBS J;  3IH4 A;  1HCR A;  2ME6 A;  5C4X J;  3HOW J;  2XPU A;  4D7M A;  5K7H A;  4A3J J;  4A69 C;  1P7I A;  4BXX J;  3I4M J;  2DMN A;  3TP3 A;  2AHQ A;  2P81 A;  3BQZ A;  1HOM A;  2QCO A;  4FE4 A;  1GDT A;  4A3G J;  4XIC A;  3O8G A;  2NOG A;  2XPV A;  1BJZ A;  3A03 A;  1MNM C;  2LVS A;  2NS8 A;  4JP0 A;  3LSG A;  1B72 A;  1OCT C;  4GFB A;  1K61 A;  5EYR A;  1TWG J;  4XID A;  1JT0 A;  1U9N A;  1HDD C;  2R7Z J;  2O7O A;  1IGN A;  2YU9 J;  3QPS A;  2DA1 A;  1E3O C;  2X48 A;  1T56 A;  2CRG A;  4B3A A;  5M3F J;  3Q0W A;  1JJ8 C;  1WGX A;  2M8G X;  1XC5 A;  1K83 J;  1HLV A;  1MBG A;  1Y1V J;  2E2H J;  5F04 A;  1HF0 A;  1JKQ C;  1IJW C;  1FIA A;  1UHS A;  3CQZ J;  3K7A J;  4Y52 J;  1ZK8 A;  1IV6 A;  3BR2 A;  3PO3 J;  3BG9 A;  3ZOB A;  4MFE A;  1AKH A;  5IP6 A;  2X6O A;  3HB9 A;  5F0F A;  2MSY A;  3CCY A;  2DMT A;  2KT0 A;  3LSR A;  4AC0 A;  1MH4 A;  3A01 A;  1FJL A;  4FIS A;  2R0Q C;  2JA6 J;  4A3D J;  3JRG A;  2DA7 A;  2WAQ N;  4RBO A;  1O4X A;  5E3L A;  9ANT A;  3MN2 A;  5E3O A;  3CDL A;  4EEF G;  1IC8 A;  1UMQ A;  2Y31 A;  3LSP A;  3FIS A;  2JN6 A;  2TRT A;  3DCF A;  1Z77 A;  1B8I A;  3S17 J;  3E7L A;  5EG0 A;  3M3Y J;  3S1Q J;  1RET A;  3TP0 A;  2XGE A;  3M4O J;  3GTJ J;  1PUF B;  3S1M J;  2DN0 A;  1NK3 P;  4MFD A;  5EGO A;  4JX5 A;  1TWA J;  3BTL A;  5C4J J;  1U78 A;  1GV5 A;  1H89 C;  3OOU A;  2JMW A;  5F0H A;  4FTH A;  1BW6 A;  1XS9 A;  3WHC A;  1YRN A;  4QTR A;  2FJ1 A;  2L9R A;  4LOC A;  5GPA A;  2Y2Z A;  4MLO A;  2XGD A;  5M3M J;  3B6C A;  4M6V A;  1JUS A;  4S0H B;  2JWT A;  4DYQ A;  5GPC A;  4A3E J;  4A3F J;  2EBI A;  3HDD A;  3BTC A;  2GBY A;  2JA8 J;  1SFO J;  2VKV A;  1ORK A;  1R9T J;  3JRA A;  5IYC J;  3NAU A;  5IPA A;  2DA6 A;  3GBG A;  2O8K A;  2Y0S N;  1ZQ3 P;  3I4N J;  2DA2 A;  1FTZ A;  3K2A A;  3LSJ A;  2ME0 A;  3BTJ A;  5DTD A;  3BR3 A;  2EQR A;  3JRF A;  1VND A;  3S1N J;  2VI6 A;  4UUS B;  4I76 A;  1W0U A;  2Y9Z A;  3HOU J;  2DJN A;  4CYC A;  2X9D A;  3S14 J;  4A3L J;  2IAI A;  2FD5 A;  5BNG A;  3OSF A;  5J1U A;  3BG3 A;  4A3M J;  4Y7N J;  5F1J A;  3S15 J;  2HXI A;  2LKX A;  1Q1V A;  2KDZ A;  3G1O A;  2JA7 J;  3VPR A;  3S16 J;  1RR7 A;  1I3Q J;  2K9S A;  5EZG A;  4AUX A;  4B4C A;  5E3N A;  3SDG A;  1A6I A;  1MBE A;  5FKO A;  1ETY A;  1T33 A;  2MGQ A;  2XB5 A;  3TW7 A;  5FKK A;  1F43 A;  3UKG A;  1LFB A;  5J3L A;  1H88 C;  2H8R A;  3G1L A;  4AYB N;  1LE8 B;  2AO9 A;  4D7N A;  3O8H A;  2R5Y A;  2R5Z A;  1NTC A;  2M2E A;  2I10 A;  3WHB A;  2COB A;  3ZQI A;  5IYB J;  1MBH A;  1ETO A;  4XRM A;  2LP0 A;  1OFC X;  4D5F A;  2LD5 A;  3BT9 A;  4IHV A;  3JRC A;  1JTY A;  1JUP A;  5K7F A;  5M5X J;  5F0C A;  4A3B J;  1ZTR A;  2DMP A;  3MVP A;  1AHD P;  2XSD C;  1GUU A;  1X2N A;  2EZI A;  3TW6 A;  2HOA A;  5DS9 A;  3HEF A;  1FTT A;  3IH2 A;  2CQQ A;  1ZGW A;  1HDP A;  3GTO J;  1H8A C;  2E1O A;  1G2H A;  1BL0 A;  3ZQF A;  4C3H J;  2CUE A;  4X1E A;  4BBR J;  1MSE C;  1IUF A;  4M3E A;  5J1Y A;  2NVQ J;  2E2I J;  2NS7 A;  3SFI A;  2M0C A;  1ETK A;  4C3J J;  3CMY A;  1VF9 A;  2Y30 A;  3B6A A;  2FX0 A;  2VKE A;  2XGC A;  1JJ6 C;  4W97 A;  2XPW A;  3GTM J;  3LNQ A;  1B72 B;  1P7J A;  3JRB A;  1FEX A;  5FLM J;  4V2G A;  2CQX A;  1ENH A;  2EZL A;  2EZK A;  2LR8 A;  1I50 J;  2EZH A;  1MH3 A;  2L0K A;  4A3C J;  4HNV A;  1X58 A;  1QRY A;  2G0E A;  4B1R A;  3S1R J;  4UUT A;  2QF7 A;  5FKN A;  4A93 J;  1LFU P;  1JGG A;  2NVX J;  2M9H A;  2L7Z A;  1D5Y A;  3FK7 A;  3JR9 A;  3ZQC A;  1JTX A;  4FE7 A;  2MG4 A;  2L7M P;  1DU0 A;  4BKX A;  1MBJ A;  1AKH B;  3OIO A;  3JRH A;  3GTL J;  3JRI A;  2CJJ A;  1NK2 P;  4MO7 A;  2PMZ N;  2B63 J;  3GTQ J;  4DZJ A;  3A01 B;  2JK3 A;  1U9O A;  1ZR2 A;  2L7F P;  1I6H J;  3PM1 A;  1BW5 A;  1AU7 A;  3HKZ N;  4M3B A;  1JT6 A;  3H0G J;  1EF4 A;  4QIW N;  2HDD A;  4X6A J;  4MIM A;  1QVT A;  3RZD J;  2H1K A;  2JA5 J;  2DA5 A;  5EZH A;  3Q0U A;  3PO2 J;  2OPT A;  1APL C;  3HOZ J;  3MKL A;  2ECB A;  2HQ5 A;  1B8I B;  1QVU A;  3F0C A;  4L5E A;  5EG0 B;  3OSG A;  2DTZ A;  3NAR A;  4D5C A;  2R92 J;  3HGG A;  2N8G A;  1ETV A;  4JX4 A;  2HYJ A;  5M5Y J;  3ZQL A;  1MBF A;  3JRE A;  2CUF A;  2O9L A;  1SAN A;  1GV2 A;  5EGO B;  1VFC A;  2GLO A;  2IEK A;  4C3I J;  1TWF J;  4I6Z A;  2XRL A;  3SJM A;  1TWC J;  1RPW A;  1ZR4 A;  3FIW A;  3BR0 A;  2ELK A;  3HGY A;  5IP9 J;  4XRS A;  3HOX J;  1YRN B;  5F27 A;  3ZQG A;  4M3F A;  5FLV A;  1Z0X A;  5FKL A;  1PUF A;  1VI0 A;  4DYR A;  1MSF C;  1IRZ A;  2K9Q A;  3L1P A;  4ABZ A;  5EDN A;  4A3K J;  4IHY A;  1RKW A;  2M34 A;  2VUM J;  2MW8 A;  3BTI A;  3QPL A;  4IHW A;  1DU6 A;  1RES A;  2LK2 A;  1XG1 A;  3HBL A;  2VPR A;  1ETQ A;  5C44 J;  1QPI A;  1ETW A;  4RDU A;  5IP7 J;  3S2D J;  2LY9 A;  2YUS A;  2K9N A;  1WPK A;  5GP9 A;  5E3M A;  1WI3 A;  2E19 A;  2RAE A;  3BG5 A;  2HOS A;  4XK4 A;  3RZO J;  2NVT J;  5FKM A;  4CYC B;  3HOV J;  4BY1 J;  2YS9 A;  5JLX A;  1CQT A;  1JKO C;  3D1N I;  5C3E J;  5EF6 A;  5M5W J;  4JX6 A;  1POG A;  3S2H J;  1MBK A;  1IDY A;  4V2F A;  5FJ8 J;  2W48 A;  3Q0V A;  1UG2 A;  1JKP C;  1RKT A;  2ID3 A;  3HOY J;  2FQ4 A;  2DA4 A;  3RKQ A;  2HOT A;  1W0T A;  3LOC A;  4DYC A;  1Y1W J;  3JRD A;  4UUS A;  2IBD A;  5HOD A;  2EH3 A;  1WH7 A;  2WB1 N;  2XB0 X;  3Q3S A;  2R93 J;  1JUM A;  3W6V A;  1ETX A;  2LTP A;  3C2B A;  2D5V A;  5IYD J;  2ID6 A;  1ZKG A;  1TWH J;  2DMU A;  2ECC A;  2R5Y B;  2R5Z B;  1WH5 A;  1GVD A;  1ITY A;  4DZP A;  1OCP A;  2DA3 A;  5IOZ A;  2CU7 A;  4NDL A;  3QQA A;  4J19 A;  3GTG J;  4XRS G;  3ZQH A;  4DW6 A;  2HXO A;  3HM5 A;  4FCY A;  2ZB9 A;  3FKI J;  2TCT A;  5IOY A;  1U8B A;  1A5J A;  1S7E A;  3BR5 A;  4JYK A;  2WV1 A;  4G12 A;  5F08 A;  1BA5 A; 
#chains in the Genus database with same CATH topology
 1S72 I;  5EEA A;  2DPD A;  1FOK A;  1DP7 P;  2A5Y B;  4L18 B;  2R7X A;  2OU2 A;  3RQI A;  5D5V B;  3ZXS A;  3OL3 A;  2DK8 A;  3H3Z A;  3RYR A;  3TOB A;  2OF7 A;  3G1M A;  1G3S A;  5H20 A;  3IV5 A;  1ZH5 A;  2GM4 A;  3H3V K;  4U7B A;  3FZV A;  5CQE A;  4PJM A;  1RRJ A;  3TED A;  1G6N A;  2HFH A;  3VB2 A;  3IH3 A;  3I64 A;  3JSP A;  4A3I J;  2XAG A;  2P6S A;  3LSM A;  3DV8 A;  4M3D A;  1B4A A;  4BY7 J;  1WCM J;  2FUG 2;  2VLA A;  3L09 A;  2VJ4 A;  3LSK A;  2PFB A;  2JJ7 A;  2K40 A;  1FC3 A;  1LKX A;  2HR3 A;  2JUG A;  1Z7L A;  1VQO I;  2L02 A;  4WK8 F;  3OMY A;  5F1R A;  1U8R A;  4LK1 F;  1JGS A;  1XD7 A;  5C4X J;  2V6C A;  3SQN A;  3U1D A;  3HTS B;  1OCZ H;  2KZV A;  1P7I A;  3JSO A;  3M07 A;  3I4M J;  2AHQ A;  4FE4 A;  2DDA A;  4RGR A;  4A3G J;  3N05 A;  2NOG A;  2FBH A;  1MNM C;  1R4N B;  1OR7 C;  4JP0 A;  1B72 A;  2K27 A;  5F6F A;  4UB6 C;  2OJE D;  1K61 A;  4RAY A;  2R7Z J;  3A0H C;  1T98 A;  3HTU A;  4AIH A;  2YU9 J;  4J00 A;  4S04 A;  3FWE A;  1R5I D;  3KP5 A;  1WGX A;  3ZN0 A;  4KUM A;  1K83 J;  5KK1 A;  1Y1V J;  1QNT A;  4UB8 C;  1AWC A;  2HS5 A;  4N4O B;  1T0F A;  3PIP F;  4L5J A;  3L00 A;  4JK1 X;  1JKQ C;  3DLA A;  3BCA A;  5HS7 A;  1IJW C;  3OYJ A;  4OIR F;  3N97 A;  1QU3 A;  4XQF A;  3OR1 C;  1ZK8 A;  3KYL A;  1EA3 A;  2VT3 A;  3AAF A;  2WAE A;  3BPV A;  3DPT A;  3RPU A;  1MDM A;  4PCQ A;  3D0S A;  2H6B A;  4FET A;  2MC4 A;  3NWT A;  2YPR A;  3CCY A;  5E79 C;  2DMT A;  3JTH A;  2KT0 A;  5FFZ A;  4BAY A;  3WTX C;  3OYB A;  3LSR A;  2Z16 A;  4AID A;  2KLO A;  3A01 A;  2V4J C;  3OWT A;  1XPX A;  4AD9 A;  3JRG A;  2DA7 A;  5CYV A;  1O4X A;  2NNY A;  1HW1 A;  3GFJ A;  9ANT A;  2L7K A;  2CYY A;  2IP2 A;  3CO7 C;  2XF5 A;  3LSP A;  4C9Y A;  3F8F A;  2JN6 A;  4HZF A;  2TRT A;  4PGG A;  4WXH A;  4EM1 A;  1GLN A;  3LA7 A;  5EG0 A;  2MLK A;  3TP0 A;  4B44 A;  4EV0 A;  1D0X A;  2XGE A;  5LRS A;  3M4O J;  4L0Z B;  5HNF A;  5ICG A;  1S6L A;  4E7J A;  4L9T A;  1B6A A;  4F7Z A;  5E8I A;  2UUZ A;  2X85 A;  3CF2 A;  5J4Y A;  2QLZ A;  3RI4 A;  2W4S A;  3IKV A;  1EV7 A;  2IA2 A;  4RLF A;  2PQ8 A;  5CVJ A;  4LB5 A;  3BTL A;  5K5Q A;  3OOU A;  2WBM A;  4IX7 A;  1JI8 A;  3F23 A;  2TDX A;  2VJ5 A;  2VT2 A;  4M9Z A;  3WHC A;  4KIS A;  2FJ1 A;  1HSJ A;  3FXL A;  1Q1H A;  1A36 A;  2B9S A;  1IV8 A;  1R1V A;  2XGD A;  3BG7 A;  1T6S A;  3I9V 2;  5CPR B;  1T95 A;  2KIS A;  1YJN I;  4S0H B;  1HST A;  5GPC A;  2J5P A;  4A3E J;  4OIP F;  4IVN A;  1IN4 A;  1TW2 A;  2F4M B;  4XLA A;  2VOP A;  2DLL A;  1PP7 U;  2M1B A;  2HVS A;  1ORK A;  1FZP B;  5L3G A;  3RKY A;  3A0B C;  2V1D A;  5IPA A;  2BV6 A;  3L7W A;  4E7S A;  1YOV B;  1FBS A;  3M7G A;  3TDZ C;  2A5W A;  2VI6 A;  2M4G A;  1I6X A;  4LFU A;  3EET A;  4CGZ A;  4P9U A;  4HDV A;  2ZME B;  1FBU A;  2P0W A;  1DPR A;  3D5R C;  2IAI A;  4CZZ A;  1NG7 A;  4MGR A;  3BG3 A;  4HX4 A;  3VSK A;  1HQC A;  4A3M J;  2RNG A;  2MH9 A;  2M7B A;  3RYP A;  3S15 J;  1G3Y A;  2OCC H;  1YX5 A;  4G7Z F;  3PNV A;  3VYT B;  3G1O A;  4CCK A;  1TBX A;  4LLL A;  3AG2 H;  2AQF A;  3O2P E;  3MKW B;  2WAQ A;  3KLN A;  2YU3 A;  3VOE A;  4BJ5 C;  1MBE A;  3DTI A;  3IAM 2;  2CQ7 A;  2VAS A;  5HLI A;  3R6S A;  1KYZ A;  2PG4 A;  3CJT B;  3UNG C;  1O3R A;  1LFB A;  1HBX G;  5ERI A;  1FLI A;  5HDK A;  4CSW A;  1LE8 B;  2R5Y A;  3DEE A;  5GAD J;  2BEO A;  2DOE A;  3WHB A;  1VQN I;  5CVV A;  2E35 A;  3SZT A;  3I56 I;  4RGS A;  1L0O C;  2DFH A;  1S8N A;  4C30 A;  1LUJ B;  1NH3 A;  5DCM B;  2HYF A;  4XRM A;  1GVJ A;  1OFC X;  4D5F A;  5JVG F;  1I1S A;  4IHV A;  3JRC A;  3F8C A;  3VEP A;  3HZJ A;  1WJD A;  1Z6T A;  5F0C A;  4A3B J;  5B66 C;  2JA2 A;  3MVP A;  2D45 A;  2M4K A;  4NQW B;  3TW6 A;  1B1B A;  2HOA A;  3JTG A;  3KYC B;  3IH2 A;  2CQQ A;  1FOX A;  1A35 A;  4Q4Z F;  1PP8 F;  2BW3 B;  1H8A C;  2IGK A;  3BLY A;  1U2W A;  1XN7 A;  1U6G A;  3DBR B;  1KA8 A;  3GX4 X;  1OCC H;  1P4A A;  2E1O A;  3QRF F;  1HC8 A;  1G2H A;  1IF1 A;  4C3H J;  5D5U B;  2CUE A;  3LWF A;  4X1E A;  3HSR A;  4MQ9 F;  1IUF A;  5J1Y A;  3L2R A;  4XBF A;  3SFI A;  4EJO A;  4BHC A;  2ZXH A;  3HRS A;  5EEG A;  2M0C A;  3WG9 A;  4B09 A;  2Y30 A;  2LYC A;  2KHM A;  3BJO A;  2FX0 A;  2VKE A;  2EIM H;  3EUA A;  3WGI A;  1R23 A;  2R7Q A;  1Z21 A;  5BMZ A;  4CCO A;  2L54 A;  1XCV A;  3CO6 C;  2ZNZ A;  3K9T A;  3GZ6 A;  4O5V A;  1SVL A;  1I50 J;  4D0P A;  4XLN F;  2FF4 A;  3ZPL A;  4LK0 F;  3AG4 H;  2R7O A;  5TGT A;  1QRY A;  3AL0 C;  3S1R J;  1FP1 D;  4UUV A;  2EFN A;  2MD0 A;  3SYT A;  3SHF A;  3CCJ I;  2NVX J;  4JBA A;  3CCE I;  1D5Y A;  3RPU D;  4ON0 A;  5ICE A;  2DT5 A;  3VOD A;  3PUF A;  2Z33 A;  3CF5 F;  4BXU A;  2L7M P;  2AXT C;  3FX3 A;  4B3X A;  4B48 A;  3OIO A;  2O61 A;  5IT9 Z;  2R7V A;  3GTL J;  1NHA A;  4GYI A;  3TO9 A;  4MO7 A;  2B63 J;  4ZYG A;  4DZJ A;  4AYB A;  1ZR2 A;  1I6H J;  3QOE A;  2XAU A;  4N4N B;  1AU7 A;  1BW5 A;  4IRI A;  3H0G J;  3FXU A;  2HDD A;  3K4K A;  5FO5 A;  3H5R A;  2HTS A;  5HS8 A;  4X6A J;  2L3D A;  3FXK A;  5LEJ A;  3Q0U A;  5AIP A;  5E8G A;  1W4M A;  2ZNY A;  4Q48 A;  1RUO A;  3HOZ J;  1APL C;  2ECB A;  2NNN A;  1U5T A;  5LBQ A;  1BR1 A;  1FSH A;  3IRQ A;  2DTZ A;  3ABT A;  4A0X A;  4ZYA A;  2RV8 A;  3B02 A;  3OYN A;  3P5J A;  4HV6 A;  4XLE A;  1SEU A;  5DD4 A;  3ABU A;  2FBK A;  3WU2 C;  1YG2 A;  3JRE A;  1SMY F;  1MJB A;  1SFE A;  3K4L A;  4BDY A;  1XGO A;  4E7L A;  3ZMV A;  2GLO A;  4C3I J;  1TWF J;  3DQV C;  4I6Z A;  1LDD A;  3L2W A;  2M3A A;  4XKV A;  2FNP A;  2ELK A;  5IP9 J;  1TL8 A;  3B73 A;  2BYV E;  3ZQG A;  5DM7 F;  1O7F A;  4M3F A;  1P4X A;  4Y17 A;  5A2Q Z;  2FOW A;  1T0F C;  2PJR A;  4DYR A;  3MFK A;  1MSF C;  2K9Q A;  2IRF G;  5EDN A;  5IT3 A;  2A05 A;  2A61 A;  3HG9 A;  3BTI A;  2F4O B;  5FRO A;  1NG6 A;  3BJA A;  3HSF A;  3CCS I;  4AVP A;  2R7F A;  3VFZ A;  5CKT A;  1ETQ A;  1ETW A;  2UV1 A;  2MFZ A;  1QA6 A;  3P9K A;  2BE5 F;  4BH9 A;  3OYK A;  1O57 A;  5B1B H;  3I58 A;  2E1M B;  1WPK A;  4EJW A;  4XOT A;  2OV7 A;  5JHU A;  2K3F A;  1TT5 B;  4IHT A;  3BG5 A;  2NYX A;  4IZZ A;  2HOS A;  1LFP A;  2ZC2 A;  5ILV A;  4LD5 A;  3HOV J;  1IN7 A;  2GA1 A;  1CQT A;  2R4G A;  2VL8 A;  1X1A A;  2FQ3 A;  5C3E J;  4JX6 A;  3K4J A;  3H1C A;  4I98 B;  1YW7 A;  1WSU A;  3HOY J;  4XOR A;  3U1K A;  1L3L A;  2DA4 A;  2L9V A;  5B5E C;  1LVK A;  3LOC A;  2VBW A;  1VQ9 I;  2IBD A;  1Z7U A;  5JHF A;  3DTE A;  2K7L A;  2KJC A;  2WB1 N;  2OCE A;  3E1S A;  4BQA A;  2W85 A;  2FU4 A;  2MYS A;  2VQH A;  4EAT A;  3F22 A;  2EPF A;  2ID6 A;  1ZKG A;  4XN3 A;  3V4G A;  2O0Y A;  3QP5 A;  1X1D A;  1R22 A;  2ZXI A;  1WI9 A;  3I59 B;  5E18 F;  1WH5 A;  3ECO A;  4DZP A;  1SD7 A;  3R61 A;  5DCF A;  2LNB A;  2STT A;  3GTG J;  3OYD A;  3LFK A;  2IS1 A;  1OMI A;  2DT7 B;  1JE8 A;  2YX7 A;  2ZKZ A;  1DP3 A;  3IWF A;  4OIQ F;  1BI1 A;  4PDK A;  2OQR A;  3EPZ A;  3REO A;  5IOY A;  3EQL F;  1U8B A;  1S7E A;  1HKS A;  1LDJ A;  5BS6 A;  2FMY A;  4P5O A;  1LFU P;  5F08 A;  2I8D A;  4HLY A;  1JHH A;  4II3 A;  4RM2 A;  3MQ0 A;  1FP2 A;  2DMQ A;  4C2M J;  1XDS A;  4E70 A;  5J1R A;  1F36 A;  3QP6 A;  2LLK A;  1G4D A;  1PDN C;  2JVG A;  4CH7 A;  2Z9O A;  4I02 A;  5JLW A;  3DBH B;  2EIL H;  3DF8 A;  3U9G A;  2HI3 A;  5K7Z A;  2GXA A;  2OUM A;  1X4O A;  3EDP A;  1GXP A;  5D8L B;  2XVC A;  3V7C A;  1OJL A;  2QBY A;  2NVY J;  5LD2 C;  4A0Y A;  4F91 B;  1Y39 A;  1JKR C;  1O3Q A;  3DXJ F;  2P4W A;  5H6R A;  4KJZ A;  2Y9Y A;  4HG2 A;  3KIO A;  3IH4 A;  2ME6 A;  2M30 A;  2PBI A;  3HOW J;  5K7H A;  3S32 A;  3RDI A;  4A69 C;  3BDD A;  3PSF A;  2DMN A;  2GOM A;  2LBF B;  4ETS A;  4DBR A;  3LSI A;  4LMY A;  3KPH A;  1XGM A;  3CDI A;  2H27 A;  1B9M A;  2ZXJ A;  4BHB A;  1EJ9 A;  1QHG A;  2XPV A;  1G59 A;  2JRM A;  1E2X A;  2Y48 A;  2QYO A;  1I27 A;  3LQQ A;  4XLF A;  3CTA A;  4BU2 A;  4AWX B;  1AOY A;  3G6E I;  1LPQ A;  4A12 A;  1SVM A;  1HDD C;  3L9F A;  1IGN A;  1TTY A;  3CLO A;  3QPS A;  3BP8 A;  3ZQQ A;  1DPU A;  2MA3 A;  3F3X A;  3Q0W A;  4YEL A;  1UJ8 A;  1IN6 A;  1S3J A;  4IRG A;  3W2V A;  3CCM I;  3G71 I;  5LRR A;  1E0E A;  3BOQ A;  1R5H A;  3FMR A;  5D8K B;  2F4I A;  2K3P A;  3WTW C;  1QZY A;  2E2H J;  5CLS A;  3RKW A;  1HF0 A;  1HXD A;  1FSE A;  2Z1D A;  1FIA A;  2HOE A;  3BWG A;  2ZJP F;  1MMS A;  2BXZ A;  3CQZ J;  3A2K A;  3HOS A;  1WWX A;  3DTK A;  3E6M A;  3BR2 A;  1N25 A;  3PO3 J;  3BG9 A;  2DYS H;  3NEU A;  4MFE A;  2X6O A;  3HB9 A;  4N0B A;  4F92 B;  2ZO4 A;  3WG7 H;  1J5Y A;  1FJL A;  1MMA A;  1ZGJ A;  5BPI A;  4XKC A;  2R0Q C;  1Z3Y A;  2JA6 J;  2DCE A;  1TQM A;  4A3D J;  3P9I A;  4RBO A;  3KP7 A;  4HA8 A;  2ADU A;  2E36 A;  5LGU A;  4HEA 2;  2IGO A;  3CDL A;  5DDG A;  3R60 A;  2ZJQ F;  3CCU I;  4M71 A;  3WTU C;  4HF0 A;  3BG6 A;  2UXN A;  4BQN A;  1Z77 A;  2MLG A;  1B8I A;  3E7L A;  2GQQ A;  3M3Y J;  3S1Q J;  2BOL A;  3S3N A;  1RET A;  2Z5U A;  4UVC A;  4PFO A;  3Q9V A;  1WQ2 A;  3KZZ A;  2QQ8 A;  4IO9 F;  1PUF B;  1IAW A;  4K2E A;  2VC1 A;  1TW3 A;  2KJB A;  3S1M J;  3ESW B;  2YX4 A;  3VSL A;  3PQJ A;  2CG4 A;  3F8N A;  1ZG3 A;  2E7W A;  2M45 A;  4JX5 A;  1TWA J;  4ENN A;  4XRF A;  1B59 A;  2L9S A;  3DU5 A;  5C4J J;  1I3A A;  3E3V A;  2JMW A;  1BW6 A;  1USS A;  1ZGA A;  4AIJ A;  2UXX A;  4XM3 A;  2CH0 A;  1YRN A;  2M8E A;  3OOP A;  3PJR A;  2L9R A;  4LLN A;  5GPA A;  2Y2Z A;  3B6C A;  4M6V A;  3WU0 A;  3O3K A;  2OD5 A;  3RSN A;  4DYQ A;  2LKS A;  1W5C C;  1P2F A;  3N4M A;  3H3U A;  1DGR M;  4ITV A;  3ZCO A;  1VQ6 I;  1LEB A;  5B1A H;  2GBY A;  5D4R A;  3S2W A;  1SFO J;  1FT9 A;  3S93 A;  5FD5 A;  3FF5 A;  4UV9 A;  3JRA A;  5IYC J;  1EH8 A;  1U5T C;  2HU9 A;  3NAU A;  3M1E A;  1ONV A;  4KFC A;  1FTZ A;  3I4N J;  2DA2 A;  3KEY A;  3K2A A;  1VQK I;  3LSJ A;  4B43 A;  1WJB A;  3BR3 A;  4WWC A;  3S1N J;  4G6T B;  4UUS B;  4PSW A;  3LAP A;  2XIG A;  3HOU J;  4CYC A;  3SXY A;  4O3M A;  4A3L J;  1ZRF A;  1Y6I A;  2V79 A;  3MKZ A;  1MD0 A;  3DWL E;  2FD5 A;  3OSF A;  3NRV A;  4QLC U;  5JI6 A;  3VYS B;  3LL7 A;  2DTR A;  4Y7N J;  1R71 A;  2HXI A;  1TNS A;  2LKX A;  2K02 A;  2IA0 A;  1Q1V A;  2XAJ A;  3LST A;  3GF2 A;  1YW9 A;  1TNT A;  2K4J A;  3GFM A;  1G8X A;  1I3Q J;  2K9S A;  5EZG A;  4AUX A;  4B4C A;  1Z67 A;  4P9F A;  4LJZ F;  4N9I A;  2Y0M A;  1ETY A;  2XB5 A;  4PSX A;  5HLH A;  3OYC A;  1IN8 A;  2P5L C;  3TW7 A;  5FKK A;  2VKD A;  1F43 A;  3KP3 A;  3UKG A;  1W5S A;  4I2O A;  2B7E A;  3KP4 A;  5J3L A;  4BEH A;  1K78 B;  2XRO A;  3G1L A;  2H8R A;  4D7N A;  3O8H A;  2R5Z A;  1NTC A;  4IKF A;  2M2E A;  1R1U A;  2I10 A;  5HLG A;  5D5W B;  2COB A;  1V3F A;  1X1B A;  4I0A A;  3T8T A;  1DQU A;  5IYB J;  1HKQ A;  1MBH A;  1MIJ A;  1ZYR F;  3TBI A;  4CIC A;  1QGP A;  2ZJR F;  3H5A A;  1JUP A;  2A3S A;  1UAA A;  1ZTR A;  2DFI A;  2ESH A;  2P7C B;  1YHQ I;  1GUU A;  1X2N A;  2EZI A;  1H0M A;  1ZRD A;  3CUQ B;  5J47 A;  4LLG F;  1R4M B;  1ZGW A;  2OC6 A;  3QAH A;  1HDP A;  1F1Z A;  4YFX F;  3GTO J;  4M74 A;  4YIR X;  4WF2 A;  3OV8 A;  1ULY A;  2NS0 A;  3SFZ A;  4BGD A;  1KQ8 A;  3SEQ A;  5E17 F;  2E2I J;  3J7A O;  4UHT A;  1OKR A;  1KZH A;  3K4C A;  3KYD B;  2RN7 A;  2O3F A;  2BXY A;  1ON1 A;  2FEZ A;  1P7J A;  2VPL A;  3JRB A;  2IS2 A;  5FLM J;  4V2G A;  4ZZD A;  2EZL A;  3H9G A;  4RGX A;  4LG0 A;  4HNV A;  2RVC A;  2W24 A;  1T08 B;  4AM3 A;  2X0L A;  3HPH A;  2G0E A;  2LDU A;  3FXQ A;  3V8K A;  3G73 A;  2F5C A;  1XTA A;  3WTS C;  1YX3 A;  2DQL A;  2X1C A;  4IXA A;  1KYW A;  5FKN A;  3JW4 A;  1YLF A;  3MKY B;  1JGG A;  2ESN A;  2DQR A;  4WXD A;  3CC2 I;  3RKX A;  2K5C A;  4ANJ A;  3WOD F;  1JTX A;  4ENM A;  1FX7 A;  4NC7 A;  5H6Q A;  3FXO A;  5AIQ A;  4WX9 A;  2XAS A;  1DU0 A;  2CFO A;  4HRI A;  1AKH B;  3JRH A;  4PJN A;  5CVI A;  3X2Q H;  3JRI A;  2CJJ A;  4NBQ A;  5FGM A;  5H2F C;  1T38 A;  1NK2 P;  2JK3 A;  1U9O A;  3TOA A;  4ZZL A;  2L7F P;  3GYH X;  3U2R A;  4R1H A;  2A6H F;  2X6W A;  1UFM A;  3HKZ N;  2IT0 A;  4G94 A;  1JT6 A;  4BNC A;  2CV1 A;  1UB9 A;  3ZMD A;  1W7P B;  4CYD A;  3QYB A;  2VON A;  2JA5 J;  4AVZ A;  3PO2 J;  2AQE A;  1X3W B;  4E7Z A;  2LSO A;  2ELH A;  4CUG A;  1WJC A;  1QVU A;  2LH9 A;  3OSG A;  4HF2 A;  4V19 K;  1EH6 A;  3HGG A;  1A31 A;  2IXS A;  3CZ6 A;  4RB3 C;  2XHK A;  4QPO A;  1O3T A;  4U7D A;  3CLQ A;  2HPI A;  3HSE A;  4E4H A;  2HYJ A;  3OYE A;  4G9Y A;  1MBF A;  2G7U A;  2GA2 A;  1ON2 A;  4BAC A;  4L0Y B;  3TO6 A;  5EGO B;  3WGG A;  3W2W A;  2QA4 I;  3ASN H;  1IRG A;  5TJJ A;  3OYG A;  4R8H A;  3DBL B;  1OLT A;  3IC7 A;  4F55 A;  3K70 C;  1RPW A;  4HQM A;  2LKP A;  3HGY A;  4XRS A;  1RUN A;  1J59 A;  1P9Q C;  1BJA A;  1Y56 A;  4A6D A;  3DP7 A;  5ICC A;  2HQN A;  2KDO A;  1VI0 A;  3R4K A;  3M8J A;  3L1P A;  4ABZ A;  2X1E A;  2XRN A;  3K10 A;  1DU6 A;  3OS2 A;  2LK2 A;  3J81 Z;  2EFP A;  1QPI A;  5C44 J;  3C1D A;  1T39 A;  1LEA A;  2DBB A;  2H6C A;  2LY9 A;  4CCJ A;  5LHH A;  2ISY A;  1X19 A;  3ULQ B;  4XR6 A;  1D3Y A;  3OYF A;  3OYI A;  4IL6 C;  3T5X A;  3ASO H;  3PUB A;  3H0D A;  4HLX A;  4UVB A;  4I0B A;  2E7X A;  3CDH A;  1K6O A;  4PFP A;  5FKM A;  2NVT J;  4A0Z A;  3S3O A;  1KON A;  2YS9 A;  4RM3 A;  3VYR B;  4MTD A;  4BE0 A;  4XKW A;  5D5X B;  2G7H A;  4DBQ A;  2IS4 A;  3MAJ A;  5DD8 A;  4EM0 B;  1VQ4 I;  3H36 A;  5CQG A;  5EF6 A;  5M5W J;  2R7D A;  1POG A;  4XN0 A;  1MBK A;  4ZH4 F;  2X6X A;  4OMZ A;  1UG2 A;  3CMA I;  2V1N A;  3CCR I;  4ZJZ A;  3JCU C;  3ZN1 A;  2FQ4 A;  1UEL B;  2V9K A;  1W0T A;  4I09 A;  5FRN A;  2LRD A;  1Y1W J;  1VQ5 I;  1BIA A;  3JRD A;  1BI2 A;  1Z6R A;  1G3W A;  3KP2 A;  1F4K A;  4GO1 A;  1GXQ A;  5HOD A;  3TMO A;  1WJF A;  2XAF A;  2IS6 A;  3NQO A;  2ZME A;  1X1C A;  3IRR A;  2VQL A;  1FOY A;  3BJ6 A;  2CMP A;  2K86 A;  1TQP A;  2LTP A;  2QWW A;  4HPQ A;  2A6T A;  2RKH A;  5LGN A;  2FSW A;  2BY0 A;  2E1N A;  2GIV A;  3QPT A;  2FBI A;  4NC6 A;  4MTE A;  1YW8 A;  1YS7 A;  4EGZ A;  3J80 Z;  5E1Z B;  4J19 A;  2EIN H;  2L5Q A;  4HW0 A;  4I01 A;  2HXO A;  4UNO A;  5KAI C;  2CQK A;  3SZP A;  2NRA C;  5D4S A;  4FCY A;  1ZRC A;  1BOB A;  2ZB9 A;  2STW A;  2XF6 A;  4YG2 F;  2HDC A;  3GLX A;  4L9J A;  3D5L A;  4HYE A;  2FE3 A;  3AFH A;  3CD6 I;  2V9V A;  3OL4 A;  3I0T A;  3ZP5 A;  4ZTJ A;  1W5T A;  5HVQ C;  1BA5 A;  1LE8 A;  1IDZ A;  2KRH A;  3QOD A;  4KDP A;  4UV8 A;  2PN6 A;  4A5M A;  4RB1 A;  3A02 A;  3T1B A;  2IA1 A;  2X51 A;  4M3G A;  4IHX A;  1KU7 A;  4LIT A;  3FK6 A;  4YRV A;  3VYU B;  2DI3 A;  5DCM A;  3GW2 A;  5L3D A;  1W36 C;  1S7O A;  1RNL A;  4W1U A;  4CDG A;  2P6T A;  4R79 A;  2YR2 A;  2LY1 A;  3J7Z I;  1MMD A;  2NVU B;  3CME I;  1TLH B;  5HDG A;  2DK5 A;  4NQW A;  3GTP J;  3S8P A;  3WTY C;  2Q8K A;  1IG7 A;  3BR6 A;  4L9N A;  2K9M A;  3GO5 A;  3MEX A;  3FM3 A;  4HQE A;  1FIP A;  3GTK J;  2AXL A;  4XSX F;  3AKZ A;  2BW3 A;  4BHP A;  4BXF A;  1FMW A;  3BZK A;  1GT0 C;  4NHJ A;  1SAX A;  4KT6 A;  2Q0O A;  4BBS J;  4YFK F;  1HCR A;  3I5U A;  2WTE A;  2XPU A;  1QO0 D;  4HAM A;  1Y0N A;  4LIU A;  2KFD A;  4BXX J;  3TP3 A;  4P55 A;  3BQZ A;  2QM3 A;  2KQR A;  2QCO A;  4EMS A;  2JTV A;  2KIF A;  2VOD A;  1KGS A;  1BN5 A;  3DKX A;  1K4T A;  4IRH A;  1BJZ A;  4ZYD A;  2LVS A;  2VJI A;  2NS8 A;  5TIS C;  4DOZ A;  5DEQ A;  3KET A;  1ODD A;  2L01 A;  1J75 A;  3GZN B;  1JT0 A;  1U9N A;  2Z3Y A;  3FHN A;  2O7O A;  2HNH A;  2WB1 A;  3OY9 A;  2XSJ C;  2WV0 A;  4ENK A;  1E3O C;  1UCR A;  2A69 F;  2BY1 A;  5M3F J;  1DGW Y;  4B3A A;  3IKT A;  1IUY A;  2ZCW A;  4O6J A;  4AU7 A;  4B47 A;  4GRI A;  1JJ8 C;  2M8G X;  1HLV A;  3TO7 A;  3F9K A;  4G7H F;  4ZC3 A;  1DUX C;  2W1O A;  5GTH C;  5LFA A;  1YI2 I;  1BC8 C;  3MZ8 A;  5F04 A;  3D5S C;  3LSH A;  5HDN A;  1D0Y A;  1ZAR A;  4F3Q A;  3CCV I;  2V6E A;  3KZY A;  1OCO H;  1SFU A;  2HZT A;  4KT5 C;  1UHS A;  1ZG5 A;  1TP4 A;  4EM2 A;  4Y52 J;  3WE3 A;  4NUB A;  4MEY F;  3ZOB A;  4U88 A;  1SD4 A;  4YIF A;  5F0F A;  2MSY A;  5E1X A;  1WRJ A;  5KCM A;  2L9N A;  4AC0 A;  4FIS A;  1IO2 A;  3IUO A;  3DLL F;  1IW7 F;  1XSX A;  2KPM A;  1RIO H;  3WU1 B;  1CF7 B;  2BVM A;  2XGX A;  2NOJ B;  5E3L A;  3OYA A;  5IT9 K;  4PZJ A;  4IQ4 A;  3MN2 A;  5JFR A;  2JT1 A;  2HEO A;  4H4K C;  1Z9C A;  3HRT A;  1WZ2 A;  1D5V A;  1I1G A;  4A6E A;  1UG0 A;  3S17 J;  3A1Y A;  2WA0 A;  4HST A;  3W6J B;  3KEO A;  3S3M A;  4Z2Y A;  3DKY A;  1RZ4 A;  2HYG D;  4EGY A;  1R5G A;  3R0J A;  3C18 A;  2QEN A;  2DN0 A;  3TDU C;  1BC7 C;  1NK3 P;  2W00 A;  3MMY B;  1XB4 A;  4MFD A;  1QZZ A;  1TQI A;  1BR2 A;  2BGC A;  3FKJ A;  2EFQ A;  5KHD A;  4CO8 A;  1U78 A;  1H89 C;  1XDU A;  3H92 A;  3K6G A;  4GXO A;  3BPX A;  3K4N A;  5F0H A;  4FTH A;  1XS9 A;  5BOX A;  4OMY A;  1X3Z B;  3FMS A;  4G6D A;  4JOM A;  1MW7 A;  3K69 A;  4QTR A;  3OYH A;  4LOC A;  5FRM A;  2A68 F;  4BL0 B;  1K4S A;  3V7S A;  2XAH A;  4KYW A;  3V7R A;  1YQA A;  1U3E M;  3LAJ A;  1JUS A;  1PJR A;  2DFF A;  3BRO A;  3W6K B;  4A3F J;  1JHF A;  2EBI A;  3PFI A;  2MD5 A;  4ZDL A;  3HDD A;  2ISZ A;  3BTC A;  2W84 A;  3CCQ I;  4FX4 A;  1H9T A;  1VQL I;  4ZYH A;  3HUG B;  2VKV A;  1YE9 A;  1R9T J;  5A2Q K;  4M9X A;  2Y0S N;  3BC8 A;  1ZQ3 P;  2DOD A;  1HKT A;  4IQJ A;  3BTJ A;  2F5V A;  5DTD A;  1T8I A;  1HA8 A;  3GXO A;  2LOO A;  1N77 A;  4U0V A;  4RLQ A;  1VZ0 A;  2BZT A;  2VQG A;  4I76 A;  3RCO A;  1VQM I;  1XSD A;  1W0U A;  2Y9Z A;  2JSP A;  1FPQ A;  2Q2E B;  3DPL C;  3GEZ A;  4FHT A;  4KN4 X;  1D0Z A;  2WC2 A;  2LY2 A;  4RA2 A;  4ESJ A;  3KLO A;  3Q5F A;  5FLX K;  4BJT A;  2X4H A;  3KFW X;  4DIQ A;  2EIK H;  5J1U A;  3F6V A;  2GXG A;  3O6B B;  5F1J A;  2FA5 A;  5KNL A;  5BPD A;  1Y0U A;  2RQP A;  2BY2 A;  3CES A;  2JA7 J;  1V5G A;  3VPR A;  4E7K A;  1RR7 A;  2K85 A;  2PMH A;  5GAH J;  1KQ9 A;  5CVU A;  3H9Q A;  1XGN A;  3ZMT A;  2R3S A;  1S9H A;  2BY3 A;  3K1M A;  1ZLK A;  1A6I A;  4OAZ A;  5FKO A;  1T33 A;  2CO5 A;  2MGQ A;  4XON A;  1S29 A;  3E6D A;  2COM A;  4Q47 A;  1OYI A;  2P8T A;  3OIQ A;  3C3W A;  2KKO A;  4BUP A;  2DT6 A;  3AL0 B;  1H88 C;  1IXS B;  1TT0 A;  4GCV A;  5DUI A;  2QZ8 A;  2AO9 A;  4KIB A;  3I59 A;  5FD6 A;  3F8B A;  4EJT A;  4PGH A;  4EQQ A;  1SC7 A;  5AON A;  3RQ4 A;  4C2T A;  2LD5 A;  3P9C A;  1BBY A;  3EUH A;  4L9V A;  1AHD P;  3RTR A;  1FBQ A;  2XSD C;  2KIU A;  4UVA A;  4U0Y A;  2QQA A;  2LF7 A;  4UY8 I;  4Q5S F;  3F6O A;  3ONQ A;  2R7U A;  4EJU A;  4UXN A;  1W1W E;  3I55 I;  4KMF A;  3PNT A;  3WTZ A;  2V26 A;  2CW7 A;  2BHY A;  5BQT A;  2OZ6 A;  2VOO A;  2ZME C;  3BY6 A;  4NNJ A;  3CMM A;  5J40 A;  4XNF A;  3IP4 B;  4I99 C;  4OAY A;  1VQ7 I;  2VBZ A;  5DM6 F;  5TRD A;  3MZH A;  4M9S A;  3K4M A;  3E6C C;  3GCM A;  1BOA A;  1F5T A;  1R58 A;  2X1D A;  1ETK A;  1SD5 A;  4C3J J;  3CMY A;  1VF9 A;  3L2V A;  1WHU A;  2V7F A;  4HDU A;  4W97 A;  3LNQ A;  1OYW A;  1B72 B;  1FEX A;  1LJ9 A;  2CQX A;  3R0A A;  3J7A Y;  4Y33 A;  1MH3 A;  2L0K A;  5K5O A;  4A3C J;  1BIB A;  2QKL B;  5FFX A;  2FRH A;  1X58 A;  1MND A;  1P4W A;  3FM5 A;  2LBF A;  3QWL A;  2QF7 A;  2Z99 A;  4KMU X;  2Z2S B;  4A93 J;  1HW2 A;  1ZEL A;  4B8X A;  1E3P A;  2L7Z A;  3H5N A;  2XKP A;  3JR9 A;  2QQ9 A;  3I4P A;  2MG4 A;  3OYL A;  3L2U A;  1QPM A;  4BKX A;  2QKM B;  5DYM A;  1MDM B;  3H35 A;  2EV5 A;  3WTV C;  1Z05 A;  4CXF A;  2FXA A;  1OQY A;  3FHZ A;  3A01 B;  3KP6 A;  2PI0 A;  1XMA A;  1LNW A;  3PM1 A;  4PJL A;  3JAM K;  4DGW B;  3TGN A;  4QIW N;  4LIV A;  3LMM A;  4GGG A;  4RMN A;  4MIM A;  5LLQ A;  2CSO A;  3RZD J;  3SDB A;  2O03 A;  1FYL A;  2QGU A;  2HQ5 A;  1K6Y A;  5EG0 B;  4IJA A;  2R92 J;  4D5C A;  4HX7 A;  2N8G A;  5LHI A;  2V9P A;  2VKH A;  4JX4 A;  3TKY A;  2R7S A;  5M5Y J;  4BQO A;  2CUF A;  2O9L A;  4BS9 A;  1UHM A;  3A4C A;  2EV0 A;  4LG0 B;  5D6F A;  1VFC A;  1QZE A;  4KA4 A;  2IEK A;  2ZJ2 A;  1VTN C;  1V5F A;  2DAO A;  1TZL A;  3SJM A;  1TWC J;  3W3C A;  2EJR A;  2WY7 Q;  3CP2 A;  3BR0 A;  3E6B A;  2VBY A;  5HS9 A;  2Y75 A;  4OIN F;  1WJA A;  1RR8 C;  1YIO A;  3E97 A;  1E3H A;  3FMQ A;  5FLV A;  1Z0X A;  2GOX B;  3F8M A;  1YYV A;  1PUF A;  2D1H A;  2PLY A;  1IRZ A;  4A3K J;  1YFH A;  1RKW A;  2M34 A;  2CGP A;  2MW8 A;  5J4V A;  3QPL A;  2HVR A;  1H9G A;  1XG1 A;  4HX8 A;  4Y15 A;  2YUS A;  3OS0 A;  3QOP A;  2JZY A;  1P6R A;  4ZDP A;  3K0L A;  5GP9 A;  5E3M A;  1WI3 A;  2E60 A;  2VN2 A;  2CV0 A;  2F5D A;  2RAE A;  2O6G E;  3KX2 A;  5ILU A;  3KEQ A;  3RZO J;  2OA4 A;  2VC0 A;  3I54 A;  2QSG X;  3UR3 C;  1FWZ A;  1ZN2 A;  1R00 A;  5JLX A;  1JKO C;  1UST A;  3QU3 A;  2GAU A;  3QU6 A;  3S2H J;  1FY7 A;  2IPQ X;  1IDY A;  1MJ9 A;  3GFL A;  4F93 B;  3EYI A;  2NXN B;  5EJC A;  3Q0V A;  1JKP C;  1R7J A;  1RKT A;  1P92 A;  2A6E F;  4E7I A;  4LGW A;  2RDP A;  2HOT A;  3DPU A;  1FMV A;  1SD6 A;  3K4B A;  2GZW A;  3HKZ A;  1OIS A;  4OOI A;  4PJ0 C;  4UUS A;  3K70 D;  2EH3 A;  1WH7 A;  3ABL H;  4XSZ F;  1XX5 A;  3ERM A;  2H94 A;  3HC7 A;  3Q3S A;  4XL9 A;  2HVQ A;  5ICF A;  4KNY A;  2R93 J;  3K1P A;  2ZSI B;  4RS8 A;  1ETX A;  2D5V A;  3C2B A;  3I53 A;  3OS1 A;  2DMU A;  2ECC A;  2R5Y B;  1GVD A;  4N9H A;  4M72 A;  4CCM A;  5IOZ A;  2RGV A;  3MZY A;  2GWR A;  3HJE A;  1MJA A;  4XRS G;  3ZMZ A;  4ESB A;  1QHH D;  4XLP F;  2WWY A;  4HV5 A;  3SEZ A;  1X1P A;  2DU9 A;  3HM5 A;  1T2K A;  3NWS A;  1MKM A;  2EV6 A;  3FKI J;  3MWM A;  1M1E B;  1A5J A;  3BR5 A;  1O7L A;  1REP C;  2WV1 A;  1EH7 A;  2V1X A;  4IOC F;  1K78 A;  2E1M C;  4IF4 A;  2VE9 A;  3WGH A;  1X2M A;  2F6C A;  1SFX A;  1LVA A;  2OQG A;  2L4M A;  2E71 A;  2DW4 A;  2HQR A;  2V1U A;  3AG3 H;  3BR1 A;  2LFB A;  2YSR A;  4QSH A;  1TC3 C;  1WFX A;  1J09 A;  3CP8 A;  4KIG A;  3DEW A;  5LHG A;  3ABM H;  2L2O A;  1YIT I;  4IEJ A;  1XSV A;  5JR3 A;  3COA C;  2LRE A;  1JXS A;  3BQY A;  2E2J J;  5K5R A;  3CUQ A;  1WJE A;  2K9L A;  2RNJ A;  2JPC A;  3HPG A;  5J8F A;  1WVR A;  3LFU A;  4FT8 A;  2VB6 A;  3GUD A;  1STZ A;  2XDV A;  4NC8 A;  5L3F A;  1QBJ A;  3ISP A;  3MD2 A;  1K7A A;  4D7M A;  3CC4 I;  4A3J J;  1Z1D A;  4M6Y A;  4DNC A;  4I7H A;  2PJP A;  1FOW A;  2P81 A;  2IW5 A;  3W2A A;  1HOM A;  1GDT A;  1J2X A;  3HHH A;  3P7N A;  4XIC A;  4P1W A;  3O8G A;  2E5N A;  4AIK A;  1IN5 A;  4G7O F;  3A03 A;  5KVR A;  1MZB A;  1J9I A;  3DFG A;  3LSG A;  4YII A;  3PQK A;  3OYM A;  5J6X A;  1OCT C;  3CC7 I;  4GFB A;  4Y4R A;  1Z3X A;  5EYR A;  1TWG J;  2WAF A;  4XID A;  1S5L C;  3M9A A;  3FXM A;  3EYY A;  2PEX A;  1MMN A;  3EUH C;  2DA1 A;  1KU3 A;  3KCC A;  2X48 A;  1T56 A;  2CRG A;  2H09 A;  2JUC A;  1XC5 A;  5EEH A;  2OTL I;  1IRX A;  1MBG A;  1XMK A;  2O8X A;  4X0G A;  4IPA A;  2EFW A;  1W36 D;  2CW8 A;  4M73 A;  4J01 A;  3ECH A;  1LQ1 A;  4MEX F;  2AS5 F;  4HSR A;  5JVT A;  3CUO A;  2MC3 A;  3HIF A;  4CCN A;  4RB2 C;  4LB6 B;  4QWQ A;  3K7A J;  2W57 A;  2MH2 A;  1IV6 A;  2VE8 A;  1R36 A;  4Y13 A;  2QUF A;  1AKH A;  1U5T B;  4D1Q A;  4XKB A;  5IP6 A;  1ZRE A;  1FNN A;  1S7A A;  2HGC A;  1LB2 A;  1MH4 A;  4HF1 A;  4DQ2 A;  1OYY A;  4CHU A;  2WAQ N;  4KIF A;  2LG4 A;  2CWE A;  1R49 A;  1Y8R B;  1W7P A;  5GAE J;  5E3O A;  2JRT A;  4EEF G;  4ZTF A;  3ABK H;  1IC8 A;  2M7A A;  3ZRG A;  1UMQ A;  3L2C A;  2Y31 A;  5DV5 A;  3E5Q A;  3FIS A;  1WJ5 A;  2BHZ A;  4JQF A;  3DCF A;  2DOF A;  4A5N A;  4H0E A;  1SFK A;  4WXC A;  3GTJ J;  2M0M A;  1EKE A;  1E17 A;  4OU0 A;  2PJR B;  1V4R A;  3E5X A;  3FBN B;  1D1C A;  4RB0 A;  2VXD A;  2D2W A;  3BZ6 A;  3IWZ A;  2DJI A;  5EGO A;  1B9N A;  4IOA F;  1N78 A;  4BE2 A;  3V8L A;  5E1W A;  3FXR A;  4KN7 X;  3FBI B;  1IXR C;  2LMD A;  1GV5 A;  1WKM A;  2BVL A;  4OWR B;  2QEX I;  2EFO A;  2IJL A;  2J5O A;  2W7N A;  4NB5 A;  1XMX A;  2QVO A;  1ERD A;  4MLO A;  5M3M J;  3DKW A;  2CUZ A;  2L4A A;  4RAZ A;  3G2B A;  2JWT A;  5F64 A;  1MGT A;  1MNE A;  3ERE D;  1RC9 A;  2Q1Z B;  5CJ9 A;  1X3U A;  2VBX A;  2XKO A;  2DXI A;  2JA8 J;  1UZC A;  2EA2 A;  2W82 A;  2ELJ A;  2P5V A;  1ZLJ A;  2DA6 A;  3GBG A;  2O8K A;  4F52 A;  3OR2 C;  2ME0 A;  2UZK A;  2EQR A;  1Y8Q B;  3JRF A;  1VND A;  3BCB A;  5ED4 A;  4BJ6 C;  3J81 K;  4FX0 A;  4BYY A;  2DJN A;  3PFY A;  4PK4 A;  2X9D A;  3S14 J;  3PNY A;  3CCL I;  4WCG A;  3C7J A;  3QPH A;  2KRC A;  2KIQ A;  2DDB A;  5BNG A;  5L3C A;  4CZC A;  3Q9S A;  4Y3O A;  2FOK A;  4S05 A;  2R7W A;  2E34 A;  2KDZ A;  2DFE A;  2HTJ A;  3DEU A;  3VDX A;  1CGP A;  2P7V B;  3S16 J;  1HW5 A;  1BI0 A;  3ELK A;  3L2Q A;  5E3N A;  3SDG A;  2Y69 H;  3V8J A;  2MBF A;  4FQG A;  1D8J A;  3GVA A;  2P5K A;  3RPQ A;  2XC7 A;  6PAX A;  2ZFU A;  3GLL A;  1F9N A;  1XCB A;  3H9J A;  1BR4 A;  5J8C A;  1I5Z A;  3K1N A;  4AYB N;  4GDF A;  3PIO F;  3QYF A;  3ZR8 X;  5CVR A;  5HLT A;  4EJV A;  2VIX A;  4FAS D;  2D1V A;  2F2E A;  1OR7 A;  3ZQI A;  1R6R A;  2KZG A;  3G3Z A;  2XF7 A;  2H1L A;  4RAF A;  1ETO A;  1J7K A;  2LP0 A;  3E5U A;  3BT9 A;  5FB2 A;  1FYM A;  1JTY A;  4YEJ A;  4BQQ A;  5K7F A;  5M5X J;  1LDK B;  1OCR H;  2O5R A;  2DMP A;  5FLX Z;  2ZSH B;  3J80 K;  2EWN A;  2GIZ A;  5DS9 A;  3HEF A;  2QBY B;  1FTT A;  3HHG A;  2E5Z A;  5IY5 H;  2KIM A;  3KZI C;  3GFI A;  3WE2 A;  1BL0 A;  2I5U A;  2M87 A;  2VXZ A;  3M1C A;  3ZQF A;  2B0L A;  1V5E A;  4BBR J;  1K79 A;  1PYV A;  1MSE C;  1X4P A;  1IRF A;  2ETH A;  4M3E A;  2NVQ J;  2DOA A;  2C6Y A;  2NS7 A;  4LG3 A;  3I71 A;  4HNT A;  1ZHF A;  3PL8 A;  2PMU A;  3F21 A;  3HXL A;  2EIJ H;  3AG1 H;  3OIP A;  3B6A A;  2Y0S A;  3ROU A;  2XGC A;  2PMZ A;  1JJ6 C;  2XPW A;  2CUJ A;  3T8R A;  3GTM J;  3F72 A;  2XAQ A;  4E6K G;  1ENH A;  2EZK A;  5KAF C;  2LR8 A;  2ZBK A;  2EZH A;  4BDZ A;  1J0R A;  4D9J A;  4YFN F;  5D6E A;  1YS6 A;  2CV2 A;  1U0J A;  2XV4 S;  4B1R A;  2G9W A;  1D8K A;  4UUT A;  1MMG A;  2JPB A;  2VQC A;  2PX9 A;  5B3S H;  2QSH X;  2ZFW A;  5GAG J;  2ZXW H;  1ZG1 A;  2F5E A;  4C2U A;  2HZD A;  2M9H A;  3BZC A;  2K4B A;  4CCL A;  1GHC A;  4GYG A;  3HYI A;  3FK7 A;  3ZGK A;  1OPC A;  3ZQC A;  1SVO A;  2F5F A;  4PJJ A;  4FE7 A;  2HQA A;  4ESF A;  1KQ0 A;  3TL4 X;  3ZQ7 A;  2LC2 A;  1MBJ A;  4L5I A;  4XLC A;  2WAD A;  1FYK A;  3CJN A;  3C2H A;  4RAG A;  1SMT A;  1SAU A;  1ACI A;  2H8W A;  3RIR A;  1D1A A;  3PSI A;  2PMZ N;  1O3S A;  3GTQ J;  3GWZ A;  3J7Y J;  1W7P D;  3CUQ C;  1D1B A;  3ML6 A;  1IZ1 A;  3FDY A;  3LA2 A;  1YJW I;  1BM9 A;  4G8X A;  1UHW A;  2RQQ A;  4RGU A;  4M3B A;  2JQ7 A;  3CJQ B;  1EF4 A;  4XMY A;  4M6X A;  2CFX A;  4MQV A;  1V54 H;  2FML A;  5LEK A;  3HOT A;  3I3L A;  2NAZ A;  3DU6 A;  3LA3 A;  1PUE E;  1QVT A;  2H1K A;  1Z91 A;  2DA5 A;  5EZH A;  4PUS A;  1IXC A;  1I39 A;  1C0W A;  3WTT C;  2OPT A;  3MKL A;  1B8I B;  3F0C A;  4L5E A;  3NAR A;  4MHG A;  5E20 A;  4ZDO A;  1R1T A;  1KU2 A;  1YTY A;  1ETV A;  4Z6Y A;  4KIC A;  2VJJ A;  2BBY A;  2KP6 A;  3ZMU A;  2X6Y A;  5ILS A;  5HOO A;  3ZQL A;  1ZAO A;  1RI7 A;  2F48 A;  2HKX A;  3GME A;  5DUK A;  1DDN A;  1CF7 A;  1SAN A;  1GV2 A;  4MNU A;  3GZ5 A;  2OZU A;  3KE2 A;  4EVI A;  4ASN A;  4CA0 A;  2DYR H;  3FXJ A;  2KL4 A;  2XRL A;  4IHS A;  2EK5 A;  2EB7 A;  3ZMS A;  1ZR4 A;  3FIW A;  1YRN B;  2IGN A;  3SZG A;  3HOX J;  5F27 A;  1YO5 C;  2A07 F;  2DPU A;  2IGM A;  4ENJ A;  3EUK L;  5FKL A;  2HKO A;  5LGT A;  4OIO F;  3HRM A;  1G3T A;  4IHY A;  1VQP I;  1A04 A;  2ICW G;  2VUM J;  3JAM Z;  4IHW A;  1RES A;  5GTI C;  2HPM A;  3HBL A;  2VPR A;  2W25 A;  1BI3 A;  2OAZ A;  4ZYE A;  5IP7 J;  4RDU A;  3S2D J;  1KU9 A;  2K9N A;  4U87 A;  3E0J B;  2IVM A;  4HNU A;  2CQN A;  2E19 A;  2QSF X;  1QQI A;  3K2Z A;  2KMU A;  3C2G A;  4XK4 A;  2JSC A;  2XUB A;  4CYC B;  2CS3 A;  4G6Q A;  3IHU A;  1XGS A;  4BY1 J;  2OTJ I;  5L3E A;  4A2U A;  3D1N I;  2RRE A;  2RC4 A;  3CJR B;  3HRU A;  4P96 A;  3HUG A;  4V2F A;  5FJ8 J;  2W48 A;  2ID3 A;  2JVH A;  2R7T A;  1VQ8 I;  3U21 A;  3RKQ A;  3IAS 2;  3VWB A;  2UWM A;  1V55 H;  2M5W A;  2WY8 Q;  4DYC A;  3M8E A;  2EA4 A;  4BE1 A;  2Q2E A;  2XB0 X;  2ACJ A;  3TQN A;  2GXB A;  1JUM A;  4TV7 A;  3T0Y A;  1AA7 A;  1A6Q A;  2HWV A;  3MCZ A;  4II2 A;  5L3B A;  3W6V A;  4BEH B;  5IYD J;  4DJA A;  1TWH J;  3HL2 A;  3LQR A;  4U0W A;  2E1C A;  3QYE A;  2HDW A;  4KIT B;  2R5Z B;  2KRF A;  1N75 A;  4XLH A;  1ITY A;  1PVE A;  1OCP A;  2LF8 A;  2DA3 A;  4E7H A;  2QQB A;  3IL2 A;  2CU7 A;  4NDL A;  3QQA A;  4QPQ A;  3RJP A;  2OBP A;  3ZQH A;  4DW6 A;  2MAB A;  1YJ9 I;  2R7R A;  2DO7 A;  4HOB A;  2FNA A;  4HBL A;  5HNH A;  1YIJ I;  2TCT A;  3G4S I;  3V42 A;  4XOP A;  2CW0 F;  3M8F A;  4JYK A;  5K1Y A;  4G12 A; 
#chains in the Genus database with same CATH homology
 1LE8 A;  1IDZ A;  1X2M A;  5EEA A;  3A02 A;  2DMQ A;  3RQI A;  4C2M J;  4M3G A;  3BR1 A;  5J1R A;  1F36 A;  2LFB A;  2LLK A;  4IHX A;  4QSH A;  2OF7 A;  3FK6 A;  3G1M A;  1TC3 C;  3IV5 A;  3DEW A;  2GM4 A;  3H3V K;  5JLW A;  4W1U A;  3TED A;  4IEJ A;  3IH3 A;  4A3I J;  2HI3 A;  3BQY A;  5K7Z A;  3GTP J;  2E2J J;  4M3D A;  1IG7 A;  4BY7 J;  1WCM J;  3BR6 A;  1OJL A;  2NVY J;  1FIP A;  3GTK J;  2JJ7 A;  2K40 A;  1JKR C;  1GT0 C;  2Y9Y A;  4BBS J;  3IH4 A;  1HCR A;  2ME6 A;  5C4X J;  3HOW J;  2XPU A;  4D7M A;  5K7H A;  4A3J J;  4A69 C;  1P7I A;  4BXX J;  3I4M J;  2DMN A;  3TP3 A;  2AHQ A;  2P81 A;  3BQZ A;  1HOM A;  2QCO A;  4FE4 A;  1GDT A;  4A3G J;  4XIC A;  3O8G A;  2NOG A;  2XPV A;  1BJZ A;  3A03 A;  1MNM C;  2LVS A;  2NS8 A;  4JP0 A;  3LSG A;  1B72 A;  1OCT C;  4GFB A;  1K61 A;  5EYR A;  1TWG J;  4XID A;  1JT0 A;  1U9N A;  1HDD C;  2R7Z J;  2O7O A;  1IGN A;  2YU9 J;  3QPS A;  2DA1 A;  1E3O C;  2X48 A;  1T56 A;  2CRG A;  4B3A A;  5M3F J;  3Q0W A;  1JJ8 C;  1WGX A;  2M8G X;  1XC5 A;  1K83 J;  1HLV A;  1MBG A;  1Y1V J;  2E2H J;  5F04 A;  1HF0 A;  1JKQ C;  1IJW C;  1FIA A;  1UHS A;  3CQZ J;  3K7A J;  4Y52 J;  1ZK8 A;  1IV6 A;  3BR2 A;  3PO3 J;  3BG9 A;  3ZOB A;  4MFE A;  1AKH A;  5IP6 A;  2X6O A;  3HB9 A;  5F0F A;  2MSY A;  3CCY A;  2DMT A;  2KT0 A;  3LSR A;  4AC0 A;  1MH4 A;  3A01 A;  1FJL A;  4FIS A;  2R0Q C;  2JA6 J;  4A3D J;  3JRG A;  2DA7 A;  2WAQ N;  4RBO A;  1O4X A;  5E3L A;  9ANT A;  3MN2 A;  5E3O A;  3CDL A;  4EEF G;  1IC8 A;  1UMQ A;  2Y31 A;  3LSP A;  3FIS A;  2JN6 A;  2TRT A;  3DCF A;  1Z77 A;  1B8I A;  3S17 J;  3E7L A;  5EG0 A;  3M3Y J;  3S1Q J;  1RET A;  3TP0 A;  2XGE A;  3M4O J;  3GTJ J;  1PUF B;  3S1M J;  2DN0 A;  1NK3 P;  4MFD A;  5EGO A;  4JX5 A;  1TWA J;  3BTL A;  5C4J J;  1U78 A;  1GV5 A;  1H89 C;  3OOU A;  2JMW A;  5F0H A;  4FTH A;  1BW6 A;  1XS9 A;  3WHC A;  1YRN A;  4QTR A;  2FJ1 A;  2L9R A;  4LOC A;  5GPA A;  2Y2Z A;  4MLO A;  2XGD A;  5M3M J;  3B6C A;  4M6V A;  1JUS A;  4S0H B;  2JWT A;  4DYQ A;  5GPC A;  4A3E J;  4A3F J;  2EBI A;  3HDD A;  3BTC A;  2GBY A;  2JA8 J;  1SFO J;  2VKV A;  1ORK A;  1R9T J;  3JRA A;  5IYC J;  3NAU A;  5IPA A;  2DA6 A;  3GBG A;  2O8K A;  2Y0S N;  1ZQ3 P;  3I4N J;  2DA2 A;  1FTZ A;  3K2A A;  3LSJ A;  2ME0 A;  3BTJ A;  5DTD A;  3BR3 A;  2EQR A;  3JRF A;  1VND A;  3S1N J;  2VI6 A;  4UUS B;  4I76 A;  1W0U A;  2Y9Z A;  3HOU J;  2DJN A;  4CYC A;  2X9D A;  3S14 J;  4A3L J;  2IAI A;  2FD5 A;  5BNG A;  3OSF A;  5J1U A;  3BG3 A;  4A3M J;  4Y7N J;  5F1J A;  3S15 J;  2HXI A;  2LKX A;  1Q1V A;  2KDZ A;  3G1O A;  2JA7 J;  3VPR A;  3S16 J;  1RR7 A;  1I3Q J;  2K9S A;  5EZG A;  4AUX A;  4B4C A;  5E3N A;  3SDG A;  1A6I A;  1MBE A;  5FKO A;  1ETY A;  1T33 A;  2MGQ A;  2XB5 A;  3TW7 A;  5FKK A;  1F43 A;  3UKG A;  1LFB A;  5J3L A;  1H88 C;  2H8R A;  3G1L A;  4AYB N;  1LE8 B;  2AO9 A;  4D7N A;  3O8H A;  2R5Y A;  2R5Z A;  1NTC A;  2M2E A;  2I10 A;  3WHB A;  2COB A;  3ZQI A;  5IYB J;  1MBH A;  1ETO A;  4XRM A;  2LP0 A;  1OFC X;  4D5F A;  2LD5 A;  3BT9 A;  4IHV A;  3JRC A;  1JTY A;  1JUP A;  5K7F A;  5M5X J;  5F0C A;  4A3B J;  1ZTR A;  2DMP A;  3MVP A;  1AHD P;  2XSD C;  1GUU A;  1X2N A;  2EZI A;  3TW6 A;  2HOA A;  5DS9 A;  3HEF A;  1FTT A;  3IH2 A;  2CQQ A;  1ZGW A;  1HDP A;  3GTO J;  1H8A C;  2E1O A;  1G2H A;  1BL0 A;  3ZQF A;  4C3H J;  2CUE A;  4X1E A;  4BBR J;  1MSE C;  1IUF A;  4M3E A;  5J1Y A;  2NVQ J;  2E2I J;  2NS7 A;  3SFI A;  2M0C A;  1ETK A;  4C3J J;  3CMY A;  1VF9 A;  2Y30 A;  3B6A A;  2FX0 A;  2VKE A;  2XGC A;  1JJ6 C;  4W97 A;  2XPW A;  3GTM J;  3LNQ A;  1B72 B;  1P7J A;  3JRB A;  1FEX A;  5FLM J;  4V2G A;  2CQX A;  1ENH A;  2EZL A;  2EZK A;  2LR8 A;  1I50 J;  2EZH A;  1MH3 A;  2L0K A;  4A3C J;  4HNV A;  1X58 A;  1QRY A;  2G0E A;  4B1R A;  3S1R J;  4UUT A;  2QF7 A;  5FKN A;  4A93 J;  1LFU P;  1JGG A;  2NVX J;  2M9H A;  2L7Z A;  1D5Y A;  3FK7 A;  3JR9 A;  3ZQC A;  1JTX A;  4FE7 A;  2MG4 A;  2L7M P;  1DU0 A;  4BKX A;  1MBJ A;  1AKH B;  3OIO A;  3JRH A;  3GTL J;  3JRI A;  2CJJ A;  1NK2 P;  4MO7 A;  2PMZ N;  2B63 J;  3GTQ J;  4DZJ A;  3A01 B;  2JK3 A;  1U9O A;  1ZR2 A;  2L7F P;  1I6H J;  3PM1 A;  1BW5 A;  1AU7 A;  3HKZ N;  4M3B A;  1JT6 A;  3H0G J;  1EF4 A;  4QIW N;  2HDD A;  4X6A J;  4MIM A;  1QVT A;  3RZD J;  2H1K A;  2JA5 J;  2DA5 A;  5EZH A;  3Q0U A;  3PO2 J;  2OPT A;  1APL C;  3HOZ J;  3MKL A;  2ECB A;  2HQ5 A;  1B8I B;  1QVU A;  3F0C A;  4L5E A;  5EG0 B;  3OSG A;  2DTZ A;  3NAR A;  4D5C A;  2R92 J;  3HGG A;  2N8G A;  1ETV A;  4JX4 A;  2HYJ A;  5M5Y J;  3ZQL A;  1MBF A;  3JRE A;  2CUF A;  2O9L A;  1SAN A;  1GV2 A;  5EGO B;  1VFC A;  2GLO A;  2IEK A;  4C3I J;  1TWF J;  4I6Z A;  2XRL A;  3SJM A;  1TWC J;  1RPW A;  1ZR4 A;  3FIW A;  3BR0 A;  2ELK A;  3HGY A;  5IP9 J;  4XRS A;  3HOX J;  1YRN B;  5F27 A;  3ZQG A;  4M3F A;  5FLV A;  1Z0X A;  5FKL A;  1PUF A;  1VI0 A;  4DYR A;  1MSF C;  1IRZ A;  2K9Q A;  3L1P A;  4ABZ A;  5EDN A;  4A3K J;  4IHY A;  1RKW A;  2M34 A;  2VUM J;  2MW8 A;  3BTI A;  3QPL A;  4IHW A;  1DU6 A;  1RES A;  2LK2 A;  1XG1 A;  3HBL A;  2VPR A;  1ETQ A;  5C44 J;  1QPI A;  1ETW A;  4RDU A;  5IP7 J;  3S2D J;  2LY9 A;  2YUS A;  2K9N A;  1WPK A;  5GP9 A;  5E3M A;  1WI3 A;  2E19 A;  2RAE A;  3BG5 A;  2HOS A;  4XK4 A;  3RZO J;  2NVT J;  5FKM A;  4CYC B;  3HOV J;  4BY1 J;  2YS9 A;  5JLX A;  1CQT A;  1JKO C;  3D1N I;  5C3E J;  5EF6 A;  5M5W J;  4JX6 A;  1POG A;  3S2H J;  1MBK A;  1IDY A;  4V2F A;  5FJ8 J;  2W48 A;  3Q0V A;  1UG2 A;  1JKP C;  1RKT A;  2ID3 A;  3HOY J;  2FQ4 A;  2DA4 A;  3RKQ A;  2HOT A;  1W0T A;  3LOC A;  4DYC A;  1Y1W J;  3JRD A;  4UUS A;  2IBD A;  5HOD A;  2EH3 A;  1WH7 A;  2WB1 N;  2XB0 X;  3Q3S A;  2R93 J;  1JUM A;  3W6V A;  1ETX A;  2LTP A;  3C2B A;  2D5V A;  5IYD J;  2ID6 A;  1ZKG A;  1TWH J;  2DMU A;  2ECC A;  2R5Y B;  2R5Z B;  1WH5 A;  1GVD A;  1ITY A;  4DZP A;  1OCP A;  2DA3 A;  5IOZ A;  2CU7 A;  4NDL A;  3QQA A;  4J19 A;  3GTG J;  4XRS G;  3ZQH A;  4DW6 A;  2HXO A;  3HM5 A;  4FCY A;  2ZB9 A;  3FKI J;  2TCT A;  5IOY A;  1U8B A;  1A5J A;  1S7E A;  3BR5 A;  4JYK A;  2WV1 A;  4G12 A;  5F08 A;  1BA5 A; 
...loading similar chains, please wait...
similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
similar chains in the pdb database (?% sequence similarity)

#similar chains in the Genus database (?% sequence similarity)
...loading similar chains, please wait...
#similar chains, but unknotted
...loading similar chains, please wait...
#similar chains in the pdb database (?% sequence similarity)
...loading similar chains, please wait...